Inverted Repeats Finder Program written by: Gary Benson Department of Biomathematical Sciences Mount Sinai School of Medicine Version 3.05 Sequence: pNF1 2003-09-03 Parameters: 2 3 5 80 10 40 100000 500000 -t7 600000 -d Length: 184026 ACGTcount: A:0.16, C:0.33, G:0.34, T:0.17, N:0.00 Found at i: 1967 center: 3836 interval size: 40 g: 1 Alignment explanation
Indices: 1869--1888,1948--1967 Loop: 59 Score: 40 Left Length: 20 Right Length: 20 Average length: 20.0 3 most common centers (desc): 3836 0 0 1859 >> (LF) ACCACAACGC 1977 << (RF) TCCGAGTGTA 1869 >> GGGTAAACCGCGGTTTACCC >> 1888 1967 << ******************** << 1948 Statistics Matches: 20 (100.00%), Mismatches: 0 (0.00%), Indels: 0 (0.00%) ATpairs: 40.00%, CGpairs: 60.00%, GTpairs: 0.00% :i = 1967 tupleindex: 1 intervalindex: 2 matches_in_interval: 20.0000 lowcenter: 3828 highcenter: 3844 testcenter: 3836 im3: 20.0000 frequent_center_ratio*rnkp: 7.6500 Found at i: 2034 center: 3982 interval size: 40 g: 1 Alignment explanation
Indices: 1948--1967,2015--2034 Loop: 47 Score: 40 Left Length: 20 Right Length: 20 Average length: 20.0 3 most common centers (desc): 3982 0 0 1938 >> (LF) CAAGGAACAT 2044 << (RF) CCGCTCCACC 1948 >> GGGTAAACCGCGGTTTACCC >> 1967 2034 << ******************** << 2015 Statistics Matches: 20 (100.00%), Mismatches: 0 (0.00%), Indels: 0 (0.00%) ATpairs: 40.00%, CGpairs: 60.00%, GTpairs: 0.00% :i = 2034 tupleindex: 1 intervalindex: 2 matches_in_interval: 20.0000 lowcenter: 3974 highcenter: 3990 testcenter: 3982 im3: 20.0000 frequent_center_ratio*rnkp: 7.6500 Found at i: 2034 center: 3903 interval size: 80 g: 2 Alignment explanation
Indices: 1869--1888,2015--2034 Loop: 126 Score: 40 Left Length: 20 Right Length: 20 Average length: 20.0 3 most common centers (desc): 3903 0 0 1859 >> (LF) ACCACAACGC 2044 << (RF) CCGCTCCACC 1869 >> GGGTAAACCGCGGTTTACCC >> 1888 2034 << ******************** << 2015 Statistics Matches: 20 (100.00%), Mismatches: 0 (0.00%), Indels: 0 (0.00%) ATpairs: 40.00%, CGpairs: 60.00%, GTpairs: 0.00% :i = 2034 tupleindex: 2 intervalindex: 1 matches_in_interval: 35.0000 lowcenter: 3891 highcenter: 3915 testcenter: 3903 im3: 20.0000 frequent_center_ratio*rnkp: 12.7600 Found at i: 8487 center: 16928 interval size: 40 g: 1 Alignment explanation
Indices: 8441--8460,8468--8487 Loop: 7 Score: 40 Left Length: 20 Right Length: 20 Average length: 20.0 3 most common centers (desc): 16928 0 0 8431 >> (LF) GACGAGAGAG 8497 << (RF) GGCTGCCGCA 8441 >> GAAGGCCAGGGAGGGGGCCC >> 8460 8487 << ******************** << 8468 Statistics Matches: 20 (100.00%), Mismatches: 0 (0.00%), Indels: 0 (0.00%) ATpairs: 20.00%, CGpairs: 80.00%, GTpairs: 0.00% :i = 8487 tupleindex: 1 intervalindex: 2 matches_in_interval: 36.0000 lowcenter: 16920 highcenter: 16936 testcenter: 16928 im3: 20.0000 frequent_center_ratio*rnkp: 7.6500 Found at i: 97690 center: 138910 interval size: 300 g: 3 Alignment explanation
Indices: 41192--41466,97444--97718 Loop: 55977 Score: 129 Left Length: 275 Right Length: 275 Average length: 275.0 3 most common centers (desc): 138910 138907 138909 41182 >> (LF) ATCGATCGGT 97728 << (RF) CAGCGGCGCG 41192 >> TGCACG-CCTTGG-GTATTCGTGTGTCGATGCTCACCGGTGACAAC-ACCCGCACCGCTGC-CGCCCTGGCTACC >> 41262 97718 << ******T***G**G**GCTC***-***-***********G******C*TC*-******CTTT***TAG*G*C*C* << 97647 41263 >> GAGGCCGGGATCGAGGACGTGCA-CGCGGACCTGCGCCCCGAAGACAAGGCCCGCATCGTGGGCGAACTACG-CG >> 41335 97646 << *-*GA***G*****GTG***-**A***G**TC*T*AC****CG*****T***TG**TCT*G*G********TT** << 97574 41336 >> C--CGACCGGTTCACCGCGATGGTCGGCGACGGCGTCAACGACGCCCCCGCACTGGCCACCGCCGACCTCGGTGT >> 41408 97573 << *TC**C***GGTCCA***G********************************G**G***GTT***********GT* << 97499 41409 >> GGCGATGGGTGCGATGGGTACCGACGTCGCCATCGAAACCGCCGACGTCGCCCTGATG >> 41466 97498 << G**G**G**G**G--**G-**************************A****AC**G*** << 97444 Statistics Matches: 202 (71.38%), Mismatches: 65 (22.97%), Indels: 16 (5.65%) ATpairs: 29.21%, CGpairs: 70.79%, GTpairs: 0.00% :i = 97690 tupleindex: 3 intervalindex: 1 matches_in_interval: 97.0000 lowcenter: 138886 highcenter: 138934 testcenter: 138910 im3: 43.0000 frequent_center_ratio*rnkp: 25.9200 Done.